Orthologous regulated operons containing ECA4246 gene
| Regulog: | ECA4246 - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
|
Position: -12
Score: 6.84977 Sequence: GAATGCACAGCTGTGCAAAA
Locus tag: ECA4250
Name: ECA4250 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: ECA4249
Name: ECA4249 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: ECA4248
Name: ECA4248 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: ECA4247
Name: ECA4247 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: ECA4246
Name: ECA4246 Funciton: Predicted transcriptional regulator, LacI family |
||||
| ECA4250-ECA4249-ECA4248-ECA4247-ECA4246 | -12 | 6.8 | GAATGCACAGCTGTGCAAAA | ECA4250 |