Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ECA4250 gene

Properties
Regulog: ECA4246 - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/gamma
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -12
Score: 6.84977
Sequence: GAATGCACAGCTGTGCAAAA
Locus tag: ECA4250
Name: ECA4250
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: ECA4249
Name: ECA4249
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: ECA4248
Name: ECA4248
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: ECA4247
Name: ECA4247
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: ECA4246
Name: ECA4246
Funciton: Predicted transcriptional regulator, LacI family
ECA4250-ECA4249-ECA4248-ECA4247-ECA4246 -12 6.8 GAATGCACAGCTGTGCAAAA ECA4250
© 2009-2020 RegPrecise