Orthologous regulated operons containing ECA4250 gene
Regulog: | ECA4246 - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Erwinia carotovora subsp. atroseptica SCRI1043 | ||||
Position: -12
Score: 6.84977 Sequence: GAATGCACAGCTGTGCAAAA
Locus tag: ECA4250
Name: ECA4250 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: ECA4249
Name: ECA4249 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: ECA4248
Name: ECA4248 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: ECA4247
Name: ECA4247 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: ECA4246
Name: ECA4246 Funciton: Predicted transcriptional regulator, LacI family |
||||
ECA4250-ECA4249-ECA4248-ECA4247-ECA4246 | -12 | 6.8 | GAATGCACAGCTGTGCAAAA | ECA4250 |