Orthologous regulated operons containing xltB gene
| Regulog: | XltR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylitol utilization |
| Effector: | Xylitol |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Yersinia pestis KIM | ||||
|
Position: 8
Score: 6.53671 Sequence: CAATGTTTACGTTGTCATTT
Locus tag: y1686
Name: xltF Funciton: Xylitol dehydrogenase (EC 1.1.1.9)
Locus tag: y1687
Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein
Locus tag: y1688
Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component
Locus tag: y1689
Name: xltB Funciton: Xylitol ABC transporter, permease component |
||||
| xltF-xltC-xltA-xltB | 8 | 6.5 | CAATGTTTACGTTGTCATTT | y1686 |