Orthologous regulated operons containing scrT gene
| Regulog: | ScrR - Sphingomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Erythrobacter litoralis HTCC2594 | ||||
|
Position: -112
Score: 6.08236 Sequence: CAATGCAAACGATTGCAACC
Position: -88
Score: 6.10326 Sequence: TTTTGCAATCGTTTGCAATC
Locus tag: ELI_04245
Name: scrT Funciton: Predicted sucrose transporter, MelB family
Locus tag: ELI_04250
Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family |
||||
| scrT-scrR | -112 | 6.1 | CAATGCAAACGATTGCAACC | ELI_04245 |
| -88 | 6.1 | TTTTGCAATCGTTTGCAATC | ||
| Novosphingobium aromaticivorans DSM 12444 | ||||
|
Position: -84
Score: 5.26075 Sequence: TTATGCAATCGATTGTTGTC
Locus tag: Saro_1877
Name: scrT Funciton: Predicted sucrose transporter, MelB family
Locus tag: Saro_1878
Name: COG3345 Funciton: Alpha-galactosidase (EC 3.2.1.22)
Locus tag: Saro_1879
Name: sacB Funciton: Levansucrase (EC 2.4.1.10) |
||||
| scrT-COG3345-sacB | -84 | 5.3 | TTATGCAATCGATTGTTGTC | Saro_1877 |