Orthologous regulated operons containing VV21297 gene
| Regulog: | VVA0138 - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -203
Score: 6.56967 Sequence: ACAAGCAAGCGCTTTCTTTG
Locus tag: VV21297
Name: VV21297 Funciton: Predicted transcriptional regulator, LacI family |
||||
| VV21297 | -203 | 6.6 | ACAAGCAAGCGCTTTCTTTG | VV21297 |