Orthologous regulated operons containing VV21301 gene
| Regulog: | VVA0138 - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -225
Score: 6.14693 Sequence: CCGAGAAAGCGCTTTCTTTG
Position: -49
Score: 7.17269 Sequence: TAAAGAAAGCGCTTTCTTTT
Locus tag: VV21301
Name: VV21301 Funciton: Putative maltoporin |
||||
| VV21301 | -225 | 6.1 | CCGAGAAAGCGCTTTCTTTG | VV21301 |
| -49 | 7.2 | TAAAGAAAGCGCTTTCTTTT | ||