Orthologous regulated operons containing VV21296 gene
| Regulog: | VVA0138 - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -35
Score: 7.48476 Sequence: AAAAGAAAGCGCTTTCTTTT
Locus tag: VV21296
Name: VV21296 Funciton: Hypothetical protein |
||||
| VV21296 | -35 | 7.5 | AAAAGAAAGCGCTTTCTTTT | VV21296 |