Orthologous regulated operons containing VV21298 gene
| Regulog: | VVA0138 - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -229
Score: 6.56967 Sequence: CAAAGAAAGCGCTTGCTTGT
Position: -57
Score: 7.48476 Sequence: AAAAGAAAGCGCTTTCTTTT
Locus tag: VV21298
Name: VV21298 Funciton: Exo-beta-1,3-glucanase
Locus tag: VV21300
Name: VV21300 Funciton: Beta-glucanase precursor (EC 3.2.1.73) |
||||
| VV21298-VV21300 | -229 | 6.6 | CAAAGAAAGCGCTTGCTTGT | VV21298 |
| -57 | 7.5 | AAAAGAAAGCGCTTTCTTTT | ||