Orthologous regulated operons containing Veis_4522 gene
Regulog: | Bpro_5109 - Comamonadaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Polaromonas sp. JS666 | ||||
Position: -80
Score: 5.70558 Sequence: ACGTGAATACGTATTCACAG
Position: -26
Score: 6.04472 Sequence: TTATGACTACGTATTCAAAA
Locus tag: Bpro_5109
Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bpro_5110
Name: Veis_4522 Funciton: Putative membrane protein
Locus tag: Bpro_5111
Name: Veis_4523 Funciton: Putative dehydratase |
||||
Bpro_5109-Veis_4522-Veis_4523 | -80 | 5.7 | ACGTGAATACGTATTCACAG | Bpro_5109 |
-26 | 6 | TTATGACTACGTATTCAAAA | ||
Verminephrobacter eiseniae EF01-2 | ||||
Position: -34
Score: 5.78684 Sequence: AAATGACTACGAATACATTT
Locus tag: Veis_4515
Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Veis_4516
Name: Veis_4516 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Veis_4517
Name: Veis_4517 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Veis_4518
Name: Veis_4518 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Veis_4519
Name: Veis_4519 Funciton: Predicted oxidoreductase
Locus tag: Veis_4520
Name: Veis_4520 Funciton: Predicted dehydrogenase
Locus tag: Veis_4521
Name: Veis_4521 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Veis_4522
Name: Veis_4522 Funciton: Putative membrane protein
Locus tag: Veis_4523
Name: Veis_4523 Funciton: Putative dehydratase |
||||
Bpro_5109-Veis_4516-Veis_4517-Veis_4518-Veis_4519-Veis_4520-Veis_4521-Veis_4522-Veis_4523 | -34 | 5.8 | AAATGACTACGAATACATTT | Veis_4515 |