Orthologous regulated operons containing Veis_4522 gene

Properties
Regulog:	Bpro_5109 - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Polaromonas sp. JS666
Position: -80 Score: 5.70558 Sequence: ACGTGAATACGTATTCACAG Position: -26 Score: 6.04472 Sequence: TTATGACTACGTATTCAAAA Locus tag: Bpro_5109 Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Bpro_5110 Name: Veis_4522 Funciton: Putative membrane protein Locus tag: Bpro_5111 Name: Veis_4523 Funciton: Putative dehydratase
Bpro_5109-Veis_4522-Veis_4523	-80	5.7	ACGTGAATACGTATTCACAG	Bpro_5109
	-26	6	TTATGACTACGTATTCAAAA
Verminephrobacter eiseniae EF01-2
Position: -34 Score: 5.78684 Sequence: AAATGACTACGAATACATTT Locus tag: Veis_4515 Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Veis_4516 Name: Veis_4516 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Veis_4517 Name: Veis_4517 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Veis_4518 Name: Veis_4518 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Veis_4519 Name: Veis_4519 Funciton: Predicted oxidoreductase Locus tag: Veis_4520 Name: Veis_4520 Funciton: Predicted dehydrogenase Locus tag: Veis_4521 Name: Veis_4521 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Veis_4522 Name: Veis_4522 Funciton: Putative membrane protein Locus tag: Veis_4523 Name: Veis_4523 Funciton: Putative dehydratase
Bpro_5109-Veis_4516-Veis_4517-Veis_4518-Veis_4519-Veis_4520-Veis_4521-Veis_4522-Veis_4523	-34	5.8	AAATGACTACGAATACATTT	Veis_4515