Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Veis_4519 gene

Properties
Regulog: Bpro_5109 - Comamonadaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Verminephrobacter eiseniae EF01-2
Position: -34
Score: 5.78684
Sequence: AAATGACTACGAATACATTT
Locus tag: Veis_4515
Name: Bpro_5109
Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Veis_4516
Name: Veis_4516
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Veis_4517
Name: Veis_4517
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Veis_4518
Name: Veis_4518
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Veis_4519
Name: Veis_4519
Funciton: Predicted oxidoreductase
Locus tag: Veis_4520
Name: Veis_4520
Funciton: Predicted dehydrogenase
Locus tag: Veis_4521
Name: Veis_4521
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Veis_4522
Name: Veis_4522
Funciton: Putative membrane protein
Locus tag: Veis_4523
Name: Veis_4523
Funciton: Putative dehydratase
Bpro_5109-Veis_4516-Veis_4517-Veis_4518-Veis_4519-Veis_4520-Veis_4521-Veis_4522-Veis_4523 -34 5.8 AAATGACTACGAATACATTT Veis_4515