Orthologous regulated operons containing omp(Man) gene
Regulog: | ManR1 - Alteromonadales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Mannosides utilization; Mannose utilization |
Effector: | Mannose |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Colwellia psychrerythraea 34H | ||||
Position: -152
Score: 6.38637 Sequence: GCATTGGAACGTTCCAATTA
Position: -64
Score: 5.52903 Sequence: ATAACGGAACGTTCCACTTA
Locus tag: CPS_2653
Name: omp(Man) Funciton: Mannosides-regulated TonB-dependent outer membrane receptor |
||||
omp(Man) | -152 | 6.4 | GCATTGGAACGTTCCAATTA | CPS_2653 |
-64 | 5.5 | ATAACGGAACGTTCCACTTA |