Orthologous regulated operons containing EF1410 gene
| Regulog: | EF1410 - Enterococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Enterococcus faecalis V583 | ||||
|
Position: -119
Score: 6.52087 Sequence: AATTGTTATCGTTTACATCT
Locus tag: EF1410
Name: EF1410 Funciton: Predicted transcriptional regulator, LacI family |
||||
| EF1410 | -119 | 6.5 | AATTGTTATCGTTTACATCT | EF1410 |