Orthologous regulated operons containing rbsC gene
| Regulog: | RbsR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anoxybacillus flavithermus WK1 | ||||
|
Position: -36
Score: 6.65469 Sequence: ATATGTAACCGGTTACAGAA
Locus tag: Aflv_2673
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Aflv_2672
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Aflv_2671
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Aflv_2670
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Aflv_2669
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Aflv_2668
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -36 | 6.7 | ATATGTAACCGGTTACAGAA | Aflv_2673 |
| Bacillus amyloliquefaciens FZB42 | ||||
|
Position: -35
Score: 6.34233 Sequence: TTATGTAAACGGTTACATAG
Locus tag: RBAM_033080
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: RBAM_033090
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: RBAM_033100
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: RBAM_033110
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: RBAM_033120
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: RBAM_033130
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -35 | 6.3 | TTATGTAAACGGTTACATAG | RBAM_033080 |
| Bacillus cereus ATCC 14579 | ||||
|
Position: -37
Score: 6.11595 Sequence: TTCTGTAAACGGTTACATGA
Locus tag: BC0659
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: BC0660
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: BC0661
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: BC0662
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BC0663
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC | -37 | 6.1 | TTCTGTAAACGGTTACATGA | BC0659 |
| Bacillus clausii KSM-K16 | ||||
|
Position: -35
Score: 6.38627 Sequence: ATCTGTAACCGGTTACATGT
Locus tag: ABC3549
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: ABC3548
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: ABC3547
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: ABC3546
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: ABC3545
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: ABC3544
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -35 | 6.4 | ATCTGTAACCGGTTACATGT | ABC3549 |
| Bacillus halodurans C-125 | ||||
|
Position: -35
Score: 6.69831 Sequence: ATCTGTAACCGGTTACACAT
Locus tag: BH3727
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: BH3728
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: BH3729
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: BH3730
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BH3731
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: BH3732
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -35 | 6.7 | ATCTGTAACCGGTTACACAT | BH3727 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: 17
Score: 6.51405 Sequence: TTATGTAAACGGTTACACAA
Locus tag: BLi03840
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: BLi03841
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: BLi03842
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: BLi03843
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BLi03844
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: BLi03845
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | 17 | 6.5 | TTATGTAAACGGTTACACAA | BLi03840 |
| Bacillus pumilus SAFR-032 | ||||
|
Position: -40
Score: 6.55767 Sequence: TTGTGTAAACGGTTACACAT
Locus tag: BPUM_3263
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: BPUM_3264
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: BPUM_3265
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: BPUM_3266
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BPUM_3267
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: BPUM_3268
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -40 | 6.6 | TTGTGTAAACGGTTACACAT | BPUM_3263 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -36
Score: 6.34233 Sequence: CTATGTAAACGGTTACATAA
Locus tag: BSU35910
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: BSU35920
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: BSU35930
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: BSU35940
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: BSU35950
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: BSU35960
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -36 | 6.3 | CTATGTAAACGGTTACATAA | BSU35910 |
| Geobacillus kaustophilus HTA426 | ||||
|
Position: -43
Score: 6.76675 Sequence: ATGTGTAACCGGTTACACAT
Locus tag: GK3231
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: GK3230
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: GK3229
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: GK3228
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: GK3227
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: GK3226
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -43 | 6.8 | ATGTGTAACCGGTTACACAT | GK3231 |
| Oceanobacillus iheyensis HTE831 | ||||
|
Position: -42
Score: 5.99785 Sequence: ATCTGAAACCGGTTCCATAT
Locus tag: OB2577
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: OB2576
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: OB2575
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: OB2574
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: OB2573
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: OB2572
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -42 | 6 | ATCTGAAACCGGTTCCATAT | OB2577 |
| Paenibacillus sp. JDR-2 | ||||
|
Position: -37
Score: 6.29727 Sequence: ATGTGTAAACGGTTCCACAT
Locus tag: Pjdr2_3988
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Pjdr2_3987
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Pjdr2_3986
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Pjdr2_3985
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Pjdr2_3984
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Pjdr2_3983
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
||||
| rbsR-rbsK-rbsD-rbsA-rbsC-rbsB | -37 | 6.3 | ATGTGTAAACGGTTCCACAT | Pjdr2_3988 |