Orthologous regulated operons containing rbsB gene
| Regulog: | RbsR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||||
|
Position: -76
Score: 6.5259 Sequence: TAACGCAAACGTTTGCGTCT
Locus tag: PA1946
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PA1947
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PA1948
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PA1949
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PA1950
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK | -76 | 6.5 | TAACGCAAACGTTTGCGTCT | PA1946 |
| Pseudomonas entomophila L48 | ||||
|
Position: -52
Score: 6.55293 Sequence: CACCGCAAACGTTTGCGATC
Locus tag: PSEEN1952
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PSEEN1953
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PSEEN1954
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PSEEN1955
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PSEEN1956
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PSEEN1957
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PSEEN1958
Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD-uriH | -52 | 6.6 | CACCGCAAACGTTTGCGATC | PSEEN1952 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -140
Score: 6.29544 Sequence: TTACGCAAACGTTTGCGCGG
Locus tag: PFL_2101
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PFL_2102
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PFL_2103
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PFL_2104
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PFL_2105
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PFL_2106
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PFL_2107
Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD-uriH | -140 | 6.3 | TTACGCAAACGTTTGCGCGG | PFL_2101 |
| Pseudomonas putida KT2440 | ||||
|
Position: -53
Score: 6.44527 Sequence: CAACGCAAACGTTTGCTATC
Locus tag: PP2454
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PP2455
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PP2456
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PP2457
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PP2458
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PP2459
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PP2460
Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD-uriH | -53 | 6.4 | CAACGCAAACGTTTGCTATC | PP2454 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -84
Score: 6.63194 Sequence: CCTCGCAAACGTTTGCGTGT
Locus tag: PSPTO2367
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: PSPTO2368
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: PSPTO2369
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: PSPTO2370
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: PSPTO2371
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: PSPTO2372
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: PSPTO2373
Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD-uriH | -84 | 6.6 | CCTCGCAAACGTTTGCGTGT | PSPTO2367 |