Orthologous regulated operons containing rbsC gene
| Regulog: | RbsR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||||
|
Position: -124
Score: 6.80178 Sequence: AAGCGCAAACGTTTGCGCAA
Locus tag: Aave_4196
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Aave_4197
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Aave_4198
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Aave_4199
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Aave_4200
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Aave_4201
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD | -124 | 6.8 | AAGCGCAAACGTTTGCGCAA | Aave_4196 |
| Variovorax paradoxus S110 | ||||
|
Position: -95
Score: 6.62679 Sequence: ATTAGCAAACGTTTGCGCAA
Locus tag: Vapar_4636
Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: Vapar_4637
Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: Vapar_4638
Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: Vapar_4639
Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: Vapar_4640
Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: Vapar_4641
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
||||
| rbsB-rbsA-rbsC-rbsR-rbsK-rbsD | -95 | 6.6 | ATTAGCAAACGTTTGCGCAA | Vapar_4636 |