Orthologous regulated operons containing rbsA gene

Properties
Regulog:	RbsR - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/beta

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -124 Score: 6.80178 Sequence: AAGCGCAAACGTTTGCGCAA Locus tag: Aave_4196 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Aave_4197 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Aave_4198 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Aave_4199 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: Aave_4200 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: Aave_4201 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsB-rbsA-rbsC-rbsR-rbsK-rbsD	-124	6.8	AAGCGCAAACGTTTGCGCAA	Aave_4196
Variovorax paradoxus S110
Position: -95 Score: 6.62679 Sequence: ATTAGCAAACGTTTGCGCAA Locus tag: Vapar_4636 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: Vapar_4637 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: Vapar_4638 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: Vapar_4639 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: Vapar_4640 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: Vapar_4641 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsB-rbsA-rbsC-rbsR-rbsK-rbsD	-95	6.6	ATTAGCAAACGTTTGCGCAA	Vapar_4636