Orthologous regulated operons containing cueR gene
| Regulog: | CueR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||||
|
Position: -110
Score: 4.8873 Sequence: CCCCTGACATCATGGCAAGGT
Locus tag: Aave_0033
Name: copZ Funciton: Copper chaperone
Locus tag: Aave_0032
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copZ-cueR | -110 | 4.9 | CCCCTGACATCATGGCAAGGT | Aave_0033 |
| Acidovorax sp. JS42 | ||||
|
Position: -140
Score: 5.03886 Sequence: ACCCTGACATGCTGGCAAGGT
Locus tag: Ajs_0018
Name: copZ Funciton: Copper chaperone
Locus tag: Ajs_0017
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copZ-cueR | -140 | 5 | ACCCTGACATGCTGGCAAGGT | Ajs_0018 |
| Comamonas testosteroni KF-1 | ||||
|
Position: -80
Score: 4.94241 Sequence: ACCTTGTCATGATGTTAGGGT
Locus tag: CtesDRAFT_3915
Name: copZ Funciton: Copper chaperone
Locus tag: CtesDRAFT_3914
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copZ-cueR | -80 | 4.9 | ACCTTGTCATGATGTTAGGGT | CtesDRAFT_3915 |
| Delftia acidovorans SPH-1 | ||||
|
Position: -77
Score: 5.3267 Sequence: ACCTTGCCATGGTGTCAGGGT
Locus tag: Daci_0035
Name: copZ Funciton: Copper chaperone
Locus tag: Daci_0034
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copZ-cueR | -77 | 5.3 | ACCTTGCCATGGTGTCAGGGT | Daci_0035 |
| Rhodoferax ferrireducens DSM 15236 | ||||
|
Position: 12
Score: 6.01477 Sequence: ACCTTCCCACGGTGGCAAGGT
Locus tag: Rfer_0023
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| cueR | 12 | 6 | ACCTTCCCACGGTGGCAAGGT | Rfer_0023 |
| Variovorax paradoxus S110 | ||||
|
Position: -70
Score: 4.94434 Sequence: ACATTGACATCATGAGAAGGT
Locus tag: Vapar_0030
Name: copZ Funciton: Copper chaperone
Locus tag: Vapar_0029
Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family |
||||
| copZ-cueR | -70 | 4.9 | ACATTGACATCATGAGAAGGT | Vapar_0030 |