Orthologous regulated operons containing Mpe_A1644 gene
| Regulog: | CueR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylibium petroleiphilum PM1 | ||||
|
Position: -81
Score: 5.25854 Sequence: ACCTTCCCACGTTGTCAAGGT
Locus tag: Mpe_A1644
Name: null Funciton: hypothetical protein
Locus tag: Mpe_A1645
Name: copA3 Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) |
||||
| Mpe_A1644-copA3 | -81 | 5.3 | ACCTTCCCACGTTGTCAAGGT | Mpe_A1644 |