Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cueR3 gene

Properties
Regulog: CueR - Comamonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/Beta
Built upon 25 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acidovorax sp. JS42
Position: -64
Score: 5.33325
Sequence: ACCTTCCCACGATGGTAAGCC
Locus tag: Ajs_1372
Name: copA2
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Ajs_1373
Name: cueR3
Funciton: Copper-responsive transcriptional regulator, MerR family
copA2-cueR3 -64 5.3 ACCTTCCCACGATGGTAAGCC Ajs_1372