Orthologous regulated operons containing cueR2 gene
| Regulog: | CueR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylibium petroleiphilum PM1 | ||||
|
Position: -34
Score: 5.65196 Sequence: ACTTTGCCATGATGGGAAGGT
Locus tag: Mpe_A3535
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Mpe_A3534
Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR2 | -34 | 5.7 | ACTTTGCCATGATGGGAAGGT | Mpe_A3535 |
| Polaromonas naphthalenivorans CJ2 | ||||
|
Position: -82
Score: 5.69883 Sequence: ACCCTGCCATGATGGCAAGGT
Locus tag: Pnap_4090
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Pnap_4091
Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR2 | -82 | 5.7 | ACCCTGCCATGATGGCAAGGT | Pnap_4090 |
| Polaromonas sp. JS666 | ||||
|
Position: -72
Score: 5.37456 Sequence: ACTTTCCAACAGTGGCAAGGT
Locus tag: Bpro_3496
Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Bpro_3495
Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| copA-cueR2 | -72 | 5.4 | ACTTTCCAACAGTGGCAAGGT | Bpro_3496 |
| Variovorax paradoxus S110 | ||||
|
Position: -60
Score: 4.63388 Sequence: ACTCTCCCATGGTGTGAAGGC
Locus tag: Vapar_2999
Name: cueR2 Funciton: Copper-responsive transcriptional regulator, MerR family |
||||
| cueR2 | -60 | 4.6 | ACTCTCCCATGGTGTGAAGGC | Vapar_2999 |