Orthologous regulated operons containing cg2314 gene
| Regulog: | Cg2314 - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -95
Score: 6.40613 Sequence: CTACTATAACGTTCTAGTAG
Locus tag: cg2314
Name: cg2314 Funciton: Predicted transcription regulator, LacI family |
||||
| cg2314 | -95 | 6.4 | CTACTATAACGTTCTAGTAG | cg2314 |