Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cg2314 gene

Properties
Regulog: Cg2314 - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium glutamicum ATCC 13032
Position: -95
Score: 6.40613
Sequence: CTACTATAACGTTCTAGTAG
Locus tag: cg2314
Name: cg2314
Funciton: Predicted transcription regulator, LacI family
cg2314 -95 6.4 CTACTATAACGTTCTAGTAG cg2314