Orthologous regulated operons containing cg2313 gene
| Regulog: | Cg2314 - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -51
Score: 6.40613 Sequence: CTACTAGAACGTTATAGTAG
Locus tag: cg2313
Name: cg2313 Funciton: Predicted sugar dehydrogenase
Locus tag: cg2312
Name: cg2312 Funciton: Predicted sugar isomerase |
||||
| cg2313-cg2312 | -51 | 6.4 | CTACTAGAACGTTATAGTAG | cg2313 |