Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cmeA gene

Properties
Regulog: SoxR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia sp. 383
Position: -58
Score: 6.7046
Sequence: ACTTGAAGTTAACTTCAACT
Locus tag: Bcep18194_B1004
Name: cmeA
Funciton: RND transporter, membrane fusion protein
Locus tag: Bcep18194_B1005
Name: cmeB
Funciton: RND transporter, inner membrane protein
Locus tag: Bcep18194_B1006
Name: cmeC
Funciton: RND transporter, outer membrane protein
cmeA-cmeB-cmeC -58 6.7 ACTTGAAGTTAACTTCAACT Bcep18194_B1004
© 2009-2020 RegPrecise