Orthologous regulated operons containing PF01042 gene
| Regulog: | SoxR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -55
Score: 5.80497 Sequence: ACCTCAACCGGGGTTGAGGT
Locus tag: Smlt2940
Name: PF01042 Funciton: Endoribonuclease L-PSP |
||||
| PF01042 | -55 | 5.8 | ACCTCAACCGGGGTTGAGGT | Smlt2940 |