Orthologous regulated operons containing mexE gene
Regulog: | SoxR - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Superoxide stress response |
Effector: | Paraquat |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -140
Score: 5.83997 Sequence: ACCTCGACCATGGTTGAGGT
Locus tag: Smlt1830
Name: mexE Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1831
Name: mexF Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1832
Name: PF00106 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
Locus tag: Smlt1833
Name: oprN Funciton: RND transporter, outer membrane protein |
||||
mexE-mexF-PF00106-oprN | -140 | 5.8 | ACCTCGACCATGGTTGAGGT | Smlt1830 |