Orthologous regulated operons containing PF01613 gene
| Regulog: | SoxR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -76
Score: 6.10475 Sequence: ACCTCAACCAATGTTGAGGT
Locus tag: Smlt2828
Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: Smlt2829
Name: PF01613 Funciton: Putative flavin reductase
Locus tag: Smlt2830
Name: null Funciton: Tetratricopeptide repeat protein |
||||
| sodA-PF01613-Smlt2830 | -76 | 6.1 | ACCTCAACCAATGTTGAGGT | Smlt2828 |