Orthologous regulated operons containing sodA gene
Regulog: | SoxR - Xanthomonadales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Superoxide stress response |
Effector: | Paraquat |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Stenotrophomonas maltophilia K279a | ||||
Position: -76
Score: 6.10475 Sequence: ACCTCAACCAATGTTGAGGT
Locus tag: Smlt2828
Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: Smlt2829
Name: PF01613 Funciton: Putative flavin reductase
Locus tag: Smlt2830
Name: null Funciton: Tetratricopeptide repeat protein |
||||
sodA-PF01613-Smlt2830 | -76 | 6.1 | ACCTCAACCAATGTTGAGGT | Smlt2828 |