Orthologous regulated operons containing PF07690 gene
| Regulog: | SoxR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -23
Score: 6.26083 Sequence: ACCTCAACTGCAGTTGAGGT
Locus tag: Smlt1083
Name: PF07690 Funciton: Permease of the major facilitator superfamily |
||||
| PF07690 | -23 | 6.3 | ACCTCAACTGCAGTTGAGGT | Smlt1083 |
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -92
Score: 6.2064 Sequence: ACCTCAACTTAGGTTGAGGC
Locus tag: XAC3001
Name: PF07690 Funciton: Permease of the major facilitator superfamily |
||||
| PF07690 | -92 | 6.2 | ACCTCAACTTAGGTTGAGGC | XAC3001 |