Orthologous regulated operons containing XAC0314 gene
| Regulog: | SoxR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Xanthomonas axonopodis pv. citri str. 306 | ||||
|
Position: -54
Score: 6.11731 Sequence: ACCTCAACTGCGCTTGAGGT
Locus tag: XAC0314
Name: null Funciton: Oxidative stress resistance protein |
||||
| XAC0314 | -54 | 6.1 | ACCTCAACTGCGCTTGAGGT | XAC0314 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||||
|
Position: -48
Score: 5.86382 Sequence: ACCTCAACCATGCTTTAGGT
Locus tag: XCC0300
Name: null Funciton: Oxidative stress resistance protein |
||||
| XCC0300 | -48 | 5.9 | ACCTCAACCATGCTTTAGGT | XCC0300 |