Orthologous regulated operons containing czcD2 gene

Properties
Regulog:	CadR-PbrR - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Alpha

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Phenylobacterium zucineum HLK1
Position: -103 Score: 6.47825 Sequence: ATCCTCTAGCGACTAGAGGAT Locus tag: PHZ_c1429 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: PHZ_c1430 Name: null Funciton: hypothetical protein Locus tag: PHZ_c1431 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: PHZ_c1432 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: PHZ_c1433 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein Locus tag: PHZ_c1434 Name: czcD2 Funciton: Co/Zn/Cd efflux protein
czcD-PHZ_c1430-czcC-czcB-czcA-czcD2	-103	6.5	ATCCTCTAGCGACTAGAGGAT	PHZ_c1429

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --