Orthologous regulated operons containing czcD gene

Properties
Regulog:	CadR-PbrR - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Alpha

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter sp. K31
Position: -34 Score: 6.47825 Sequence: ATCCTCTAGTGGCTAGAGGAT Locus tag: Caul_2301 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Caul_2302 Name: pbrT Funciton: Pb(II) uptake protein, ILT family
czcD-pbrT	-34	6.5	ATCCTCTAGTGGCTAGAGGAT	Caul_2301
Phenylobacterium zucineum HLK1
Position: -19 Score: 5.6668 Sequence: ATCCTCTACCTACTAGAGGAT Locus tag: PHZ_p0236 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: PHZ_p0237 Name: null Funciton: Heavy metal RND efflux outer membrane protein, CzcC family Locus tag: PHZ_p0238 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: PHZ_p0239 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: PHZ_p0240 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
czcD-PHZ_p0237-czcC-czcB-czcA	-19	5.7	ATCCTCTACCTACTAGAGGAT	PHZ_p0236

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --