Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xylH2 gene

Properties
Regulog: XylR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Brucella melitensis 16M
Position: -320
Score: 6.31375
Sequence: AATGAGGTACGTAAATCAAA
Locus tag: BMEII0146
Name: xylF2
Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF
Locus tag: BMEII0145
Name: xylG2
Funciton: Xylose ABC transporter, ATP-binding protein XylG
Locus tag: BMEII0144
Name: xylH2
Funciton: Xylose ABC transporter, permease protein XylH
xylF2-xylG2-xylH2 -320 6.3 AATGAGGTACGTAAATCAAA BMEII0146
© 2009-2020 RegPrecise