Orthologous regulated operons containing xylG2 gene
Regulog: | XylR - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Xylose utilization |
Effector: | Xylose |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Brucella melitensis 16M | ||||
Position: -320
Score: 6.31375 Sequence: AATGAGGTACGTAAATCAAA
Locus tag: BMEII0146
Name: xylF2 Funciton: Xylose ABC transporter, periplasmic xylose-binding protein XylF
Locus tag: BMEII0145
Name: xylG2 Funciton: Xylose ABC transporter, ATP-binding protein XylG
Locus tag: BMEII0144
Name: xylH2 Funciton: Xylose ABC transporter, permease protein XylH |
||||
xylF2-xylG2-xylH2 | -320 | 6.3 | AATGAGGTACGTAAATCAAA | BMEII0146 |