Orthologous regulated operons containing mll1679 gene
Regulog: | Mll1683 - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Sugar utilization |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Mesorhizobium loti MAFF303099 | ||||
Position: -313
Score: 5.92501 Sequence: CTATGGTAGCGCTACCATTT
Locus tag: mll1682
Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein
Locus tag: mll1680
Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein
Locus tag: mll1679
Name: mll1679 Funciton: sugar ABC transporter, permease protein
Locus tag: mll1678
Name: mll1678 Funciton: sugar ABC transporter, permease protein |
||||
mll1682-mll1680-mll1679-mll1678 | -313 | 5.9 | CTATGGTAGCGCTACCATTT | mll1682 |
Rhizobium etli CFN 42 | ||||
Position: -154
Score: 5.14485 Sequence: AGTTGATAGCGCTAGCAAAT
Position: -131
Score: 4.84467 Sequence: GTTTGACTGCGCTGTCAACT
Locus tag: RHE_CH01787
Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein
Locus tag: RHE_CH01788
Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein
Locus tag: RHE_CH01789
Name: mll1679 Funciton: sugar ABC transporter, permease protein
Locus tag: RHE_CH01790
Name: mll1678 Funciton: sugar ABC transporter, permease protein |
||||
mll1682-mll1680-mll1679-mll1678 | -154 | 5.1 | AGTTGATAGCGCTAGCAAAT | RHE_CH01787 |
-131 | 4.8 | GTTTGACTGCGCTGTCAACT | ||
Rhizobium leguminosarum bv. viciae 3841 | ||||
Position: -154
Score: 4.68399 Sequence: AGTTGACAGCGCTAGCAGAT
Position: -131
Score: 5.15276 Sequence: ATTTGACAGCGCTGTCAACT
Locus tag: RL1996
Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein
Locus tag: RL1997
Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein
Locus tag: RL1998
Name: mll1679 Funciton: sugar ABC transporter, permease protein
Locus tag: RL1999
Name: mll1678 Funciton: sugar ABC transporter, permease protein |
||||
mll1682-mll1680-mll1679-mll1678 | -154 | 4.7 | AGTTGACAGCGCTAGCAGAT | RL1996 |
-131 | 5.2 | ATTTGACAGCGCTGTCAACT | ||
Rhizobium sp. NGR234 | ||||
Position: -262
Score: 6.00208 Sequence: TATTGGTAGCGCTACCATTT
Locus tag: NGR_b21720
Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein
Locus tag: NGR_b21710
Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein
Locus tag: NGR_b21700
Name: mll1679 Funciton: sugar ABC transporter, permease protein
Locus tag: NGR_b21690
Name: mll1678 Funciton: sugar ABC transporter, permease protein |
||||
mll1682-mll1680-mll1679-mll1678 | -262 | 6 | TATTGGTAGCGCTACCATTT | NGR_b21720 |