Orthologous regulated operons containing mll1680 gene

Properties
Regulog:	Mll1683 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 16 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mesorhizobium loti MAFF303099
Position: -313 Score: 5.92501 Sequence: CTATGGTAGCGCTACCATTT Locus tag: mll1682 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: mll1680 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: mll1679 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: mll1678 Name: mll1678 Funciton: sugar ABC transporter, permease protein
mll1682-mll1680-mll1679-mll1678	-313	5.9	CTATGGTAGCGCTACCATTT	mll1682
Rhizobium etli CFN 42
Position: -154 Score: 5.14485 Sequence: AGTTGATAGCGCTAGCAAAT Position: -131 Score: 4.84467 Sequence: GTTTGACTGCGCTGTCAACT Locus tag: RHE_CH01787 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: RHE_CH01788 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: RHE_CH01789 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH01790 Name: mll1678 Funciton: sugar ABC transporter, permease protein
mll1682-mll1680-mll1679-mll1678	-154	5.1	AGTTGATAGCGCTAGCAAAT	RHE_CH01787
	-131	4.8	GTTTGACTGCGCTGTCAACT
Rhizobium leguminosarum bv. viciae 3841
Position: -154 Score: 4.68399 Sequence: AGTTGACAGCGCTAGCAGAT Position: -131 Score: 5.15276 Sequence: ATTTGACAGCGCTGTCAACT Locus tag: RL1996 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: RL1997 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: RL1998 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: RL1999 Name: mll1678 Funciton: sugar ABC transporter, permease protein
mll1682-mll1680-mll1679-mll1678	-154	4.7	AGTTGACAGCGCTAGCAGAT	RL1996
	-131	5.2	ATTTGACAGCGCTGTCAACT
Rhizobium sp. NGR234
Position: -262 Score: 6.00208 Sequence: TATTGGTAGCGCTACCATTT Locus tag: NGR_b21720 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: NGR_b21710 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: NGR_b21700 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_b21690 Name: mll1678 Funciton: sugar ABC transporter, permease protein
mll1682-mll1680-mll1679-mll1678	-262	6	TATTGGTAGCGCTACCATTT	NGR_b21720