Orthologous regulated operons containing Atu5239 gene
Regulog: | Atu5239 - Rhizobiales |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | |
Effector: | |
Phylum: | Proteobacteria/Alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Agrobacterium tumefaciens str. C58 (Cereon) | ||||
Position: -64
Score: 6.34682 Sequence: TAATGACAACGTTACCATCA
Position: -27
Score: 6.12675 Sequence: CAATGACAACGATACCATCG
Locus tag: Atu5233
Name: dsd Funciton: D-serine deaminase
Locus tag: Atu5234
Name: null Funciton: ABC transporter, membrane spanning protein
Locus tag: Atu5235
Name: null Funciton: ABC transporter, membrane spanning protein (amino acid)
Locus tag: Atu5236
Name: null Funciton: ABC transporter ATP-binding protein
Locus tag: Atu5237
Name: null Funciton: ABC transporter substrate-binding protein
Locus tag: Atu5238
Name: COG3608 Funciton: Predicted deacylase
Locus tag: Atu5239
Name: Atu5239 Funciton: Transcriptional regulator, LacI family |
||||
dsd-Atu5234-Atu5235-Atu5236-Atu5237-COG3608-Atu5239 | -64 | 6.3 | TAATGACAACGTTACCATCA | Atu5233 |
-27 | 6.1 | CAATGACAACGATACCATCG | ||
Bradyrhizobium japonicum USDA 110 | ||||
Position: -67
Score: 6.16221 Sequence: TAATGACAACGTTGTCATTC
Locus tag: bll3981
Name: dsd Funciton: D-serine deaminase
Locus tag: bll3980
Name: null Funciton: ABC transporter, membrane spanning protein
Locus tag: bll3979
Name: null Funciton: ABC transporter, membrane spanning protein (amino acid)
Locus tag: bll3978
Name: null Funciton: ABC transporter ATP-binding protein
Locus tag: bll3977
Name: null Funciton: ABC transporter substrate-binding protein
Locus tag: bll3976
Name: COG0251 Funciton: Putative translation initiation inhibitor, yjgF family
Locus tag: bll3975
Name: COG3608 Funciton: Predicted deacylase
Locus tag: bll3974
Name: Atu5239 Funciton: Transcriptional regulator, LacI family |
||||
dsd-bll3980-bll3979-bll3978-bll3977-COG0251-COG3608-Atu5239 | -67 | 6.2 | TAATGACAACGTTGTCATTC | bll3981 |