Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing dsd gene

Properties
Regulog: Atu5239 - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/Alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -64
Score: 6.34682
Sequence: TAATGACAACGTTACCATCA
Position: -27
Score: 6.12675
Sequence: CAATGACAACGATACCATCG
Locus tag: Atu5233
Name: dsd
Funciton: D-serine deaminase
Locus tag: Atu5234
Name: null
Funciton: ABC transporter, membrane spanning protein
Locus tag: Atu5235
Name: null
Funciton: ABC transporter, membrane spanning protein (amino acid)
Locus tag: Atu5236
Name: null
Funciton: ABC transporter ATP-binding protein
Locus tag: Atu5237
Name: null
Funciton: ABC transporter substrate-binding protein
Locus tag: Atu5238
Name: COG3608
Funciton: Predicted deacylase
Locus tag: Atu5239
Name: Atu5239
Funciton: Transcriptional regulator, LacI family
dsd-Atu5234-Atu5235-Atu5236-Atu5237-COG3608-Atu5239 -64 6.3 TAATGACAACGTTACCATCA Atu5233
-27 6.1 CAATGACAACGATACCATCG
Bradyrhizobium japonicum USDA 110
Position: -67
Score: 6.16221
Sequence: TAATGACAACGTTGTCATTC
Locus tag: bll3981
Name: dsd
Funciton: D-serine deaminase
Locus tag: bll3980
Name: null
Funciton: ABC transporter, membrane spanning protein
Locus tag: bll3979
Name: null
Funciton: ABC transporter, membrane spanning protein (amino acid)
Locus tag: bll3978
Name: null
Funciton: ABC transporter ATP-binding protein
Locus tag: bll3977
Name: null
Funciton: ABC transporter substrate-binding protein
Locus tag: bll3976
Name: COG0251
Funciton: Putative translation initiation inhibitor, yjgF family
Locus tag: bll3975
Name: COG3608
Funciton: Predicted deacylase
Locus tag: bll3974
Name: Atu5239
Funciton: Transcriptional regulator, LacI family
dsd-bll3980-bll3979-bll3978-bll3977-COG0251-COG3608-Atu5239 -67 6.2 TAATGACAACGTTGTCATTC bll3981