Orthologous regulated operons containing malY gene
| Regulog: | MalR - Sphingomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Maltose utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Novosphingobium aromaticivorans DSM 12444 | ||||
|
Position: -146
Score: 4.65651 Sequence: CATAGTATACGTATGCCATA
Locus tag: Saro_1888
Name: omp(Mal) Funciton: Predicted maltose-specific TonB-dependent receptor
Locus tag: Saro_1889
Name: thl Funciton: tryptophan halogenase, putative
Locus tag: Saro_1890
Name: malY Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: Saro_1891
Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: Saro_1892
Name: malX Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| omp(Mal)-thl-malY-malZ-malX | -146 | 4.7 | CATAGTATACGTATGCCATA | Saro_1888 |
| Sphingopyxis alaskensis RB2256 | ||||
|
Position: -249
Score: 4.23912 Sequence: GATTCGATGCGTATACGTAT
Locus tag: Sala_0181
Name: omp(Mal) Funciton: Predicted maltose-specific TonB-dependent receptor
Locus tag: Sala_0182
Name: thl Funciton: tryptophan halogenase, putative
Locus tag: Sala_0183
Name: malY Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: Sala_0184
Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
Locus tag: Sala_0185
Name: malX Funciton: Maltodextrin glucosidase (EC 3.2.1.20) |
||||
| omp(Mal)-thl-malY-malZ-malX | -249 | 4.2 | GATTCGATGCGTATACGTAT | Sala_0181 |