Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing amy gene

Properties
Regulog: MalR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization
Effector: Maltose
Phylum: Proteobacteria/Alpha
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erythrobacter litoralis HTCC2594
Position: -103
Score: 5.69369
Sequence: CATCACATTCGTATGCGTCT
Locus tag: ELI_03150
Name: malT
Funciton: Predicted maltose transporter MalT
Locus tag: ELI_03145
Name: amy
Funciton: 1,4-alpha-glucan branching enzyme (EC 2.4.1.18)
malT-amy -103 5.7 CATCACATTCGTATGCGTCT ELI_03150
© 2009-2020 RegPrecise