Orthologous regulated operons containing cadR2 gene
| Regulog: | CadR-PbrR - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -124
Score: 5.08982 Sequence: AAGCTACAGTGGGTAGAGGTT
Position: -45
Score: 4.94116 Sequence: AAGCTACAGTCGCTGTAGCAA
Locus tag: OB2597_05245
Name: cadR2 Funciton: Cadmium resistance transcriptional regulator, MerR family
Locus tag: OB2597_05250
Name: PF02694 Funciton: Protein of unknown function UPF0060
Locus tag: OB2597_05255
Name: PF01841 Funciton: Transglutaminase-like protein
Locus tag: OB2597_05260
Name: czcD3 Funciton: Co/Zn/Cd efflux protein |
||||
| cadR2-PF02694-PF01841-czcD3 | -124 | 5.1 | AAGCTACAGTGGGTAGAGGTT | OB2597_05245 |
| -45 | 4.9 | AAGCTACAGTCGCTGTAGCAA | ||