Orthologous regulated operons containing PF01841 gene
Regulog: | CadR-PbrR - Comamonadaceae |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Lead resistance; Cadmium resistance |
Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
Phylum: | Proteobacteria/Beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Methylibium petroleiphilum PM1 | ||||
Position: -55
Score: 6.00699 Sequence: ACTCTGGAGCAGCTACAGGGT
Locus tag: Mpe_A1655
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Mpe_A1654
Name: PF01841 Funciton: Transglutaminase-like protein |
||||
czcD-PF01841 | -55 | 6 | ACTCTGGAGCAGCTACAGGGT | Mpe_A1655 |