Orthologous regulated operons containing pbrR gene
| Regulog: | CadR-PbrR - Comamonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acidovorax sp. JS42 | ||||
|
Position: -54
Score: 6.29717 Sequence: ACTCTATAGTTACTATAGAGT
Locus tag: Ajs_1241
Name: pbrR Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Ajs_1240
Name: pbrT Funciton: Pb(II) uptake protein, ILT family |
||||
| pbrR-pbrT | -54 | 6.3 | ACTCTATAGTTACTATAGAGT | Ajs_1241 |
| Comamonas testosteroni KF-1 | ||||
|
Position: -44
Score: 6.30565 Sequence: ACCCTATAGCTACTATAGAGT
Locus tag: CtesDRAFT_2651
Name: pbrR Funciton: Lead resistance transcriptional regulator, MerR family |
||||
| pbrR | -44 | 6.3 | ACCCTATAGCTACTATAGAGT | CtesDRAFT_2651 |