Orthologous regulated operons containing tnpA gene

Properties
Regulog:	CadR-PbrR - Burkholderia
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/Beta

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia xenovorans LB400
Position: -61 Score: 5.49582 Sequence: ACCTTATAGTAGCTTTATAGT Locus tag: Bxe_B2911 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Bxe_B2910 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36) Locus tag: Bxe_B2909 Name: tnpA Funciton: Transposase
czcD-lspA-tnpA	-61	5.5	ACCTTATAGTAGCTTTATAGT	Bxe_B2911

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --