Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lspA gene

Properties
Regulog: CadR-PbrR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia xenovorans LB400
Position: -61
Score: 5.49582
Sequence: ACCTTATAGTAGCTTTATAGT
Locus tag: Bxe_B2911
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Bxe_B2910
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
Locus tag: Bxe_B2909
Name: tnpA
Funciton: Transposase
czcD-lspA-tnpA -61 5.5 ACCTTATAGTAGCTTTATAGT Bxe_B2911