Orthologous regulated operons containing SMb20155 gene
| Regulog: | pRL90265 - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Sinorhizobium meliloti 1021 | ||||
|
Position: -350
Score: 5.49979 Sequence: AACTGAACACGTGTGCGTAT
Position: -298
Score: 5.7191 Sequence: GATTGCTCACGTGTGCATTT
Locus tag: SMb20155
Name: SMb20155 Funciton: putative ABC transporter permease protein
Locus tag: SMb20156
Name: SMb20156 Funciton: putative ABC transporter ATP-binding protein
Locus tag: SMb20157
Name: SMb20158 Funciton: hypothetical ABC transporter periplasmic solute-binding protein
Locus tag: SMb20158
Name: SMb20158 Funciton: hypothetical ABC transporter periplasmic solute-binding protein
Locus tag: SMb20159
Name: PF00459 Funciton: Inositol monophosphatase |
||||
| SMb20155-SMb20156-SMb20158-SMb20158-PF00459 | -350 | 5.5 | AACTGAACACGTGTGCGTAT | SMb20155 |
| -298 | 5.7 | GATTGCTCACGTGTGCATTT | ||