Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing pRL90268 gene

Properties
Regulog: pRL90265 - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -152
Score: 5.78568
Sequence: TTTTGCACACGTGCTCAAAT
Locus tag: RHE_PB00139
Name: pRL90270
Funciton: putative sugar ABC transporter, substrate-binding protein
Locus tag: RHE_PB00138
Name: pRL90269
Funciton: ABC transporter, membrane spanning protein (sugar)
Locus tag: RHE_PB00137
Name: pRL90268
Funciton: ABC transporter, membrane spanning protein (sugars)
Locus tag: RHE_PB00136
Name: pRL90267
Funciton: ABC transporter, nucleotide binding/ATPase protein (sugar)
Locus tag: RHE_PB00135
Name: COG0584
Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Locus tag: RHE_PB00134
Name: pRL90265
Funciton: Transcriptional regulator, LacI family
Locus tag: RHE_PB00133
Name: PF00459
Funciton: Inositol monophosphatase
pRL90270-pRL90269-pRL90268-pRL90267-COG0584-pRL90265-PF00459 -152 5.8 TTTTGCACACGTGCTCAAAT RHE_PB00139
Rhizobium leguminosarum bv. viciae 3841
Position: -152
Score: 5.8725
Sequence: TTTTGCACACGTGCTCAATT
Locus tag: pRL90270
Name: pRL90270
Funciton: putative sugar ABC transporter, substrate-binding protein
Locus tag: pRL90269
Name: pRL90269
Funciton: ABC transporter, membrane spanning protein (sugar)
Locus tag: pRL90268
Name: pRL90268
Funciton: ABC transporter, membrane spanning protein (sugars)
Locus tag: pRL90267
Name: pRL90267
Funciton: ABC transporter, nucleotide binding/ATPase protein (sugar)
Locus tag: pRL90266
Name: COG0584
Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Locus tag: pRL90265
Name: pRL90265
Funciton: Transcriptional regulator, LacI family
Locus tag: pRL90264
Name: PF00459
Funciton: Inositol monophosphatase
pRL90270-pRL90269-pRL90268-pRL90267-COG0584-pRL90265-PF00459 -152 5.9 TTTTGCACACGTGCTCAATT pRL90270