Orthologous regulated operons containing pRL90269 gene

Properties
Regulog:	pRL90265 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -152 Score: 5.78568 Sequence: TTTTGCACACGTGCTCAAAT Locus tag: RHE_PB00139 Name: pRL90270 Funciton: putative sugar ABC transporter, substrate-binding protein Locus tag: RHE_PB00138 Name: pRL90269 Funciton: ABC transporter, membrane spanning protein (sugar) Locus tag: RHE_PB00137 Name: pRL90268 Funciton: ABC transporter, membrane spanning protein (sugars) Locus tag: RHE_PB00136 Name: pRL90267 Funciton: ABC transporter, nucleotide binding/ATPase protein (sugar) Locus tag: RHE_PB00135 Name: COG0584 Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) Locus tag: RHE_PB00134 Name: pRL90265 Funciton: Transcriptional regulator, LacI family Locus tag: RHE_PB00133 Name: PF00459 Funciton: Inositol monophosphatase
pRL90270-pRL90269-pRL90268-pRL90267-COG0584-pRL90265-PF00459	-152	5.8	TTTTGCACACGTGCTCAAAT	RHE_PB00139
Rhizobium leguminosarum bv. viciae 3841
Position: -152 Score: 5.8725 Sequence: TTTTGCACACGTGCTCAATT Locus tag: pRL90270 Name: pRL90270 Funciton: putative sugar ABC transporter, substrate-binding protein Locus tag: pRL90269 Name: pRL90269 Funciton: ABC transporter, membrane spanning protein (sugar) Locus tag: pRL90268 Name: pRL90268 Funciton: ABC transporter, membrane spanning protein (sugars) Locus tag: pRL90267 Name: pRL90267 Funciton: ABC transporter, nucleotide binding/ATPase protein (sugar) Locus tag: pRL90266 Name: COG0584 Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) Locus tag: pRL90265 Name: pRL90265 Funciton: Transcriptional regulator, LacI family Locus tag: pRL90264 Name: PF00459 Funciton: Inositol monophosphatase
pRL90270-pRL90269-pRL90268-pRL90267-COG0584-pRL90265-PF00459	-152	5.9	TTTTGCACACGTGCTCAATT	pRL90270