Orthologous regulated operons containing PF00512 gene
| Regulog: | CadR-PbrR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas entomophila L48 | ||||
|
Position: -57
Score: 5.14027 Sequence: ACCCTGATACAGCTACAGGGT
Locus tag: PSEEN4285
Name: czcR Funciton: DNA-binding heavy metal response regulator
Locus tag: PSEEN4286
Name: PF00512 Funciton: Heavy metal sensor histidine kinase |
||||
| czcR-PF00512 | -57 | 5.1 | ACCCTGATACAGCTACAGGGT | PSEEN4285 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -71
Score: 5.78683 Sequence: ACCCTATAGCTACTACAGACT
Locus tag: PFL_3147
Name: czcR Funciton: DNA-binding heavy metal response regulator
Locus tag: PFL_3148
Name: PF00512 Funciton: Heavy metal sensor histidine kinase |
||||
| czcR-PF00512 | -71 | 5.8 | ACCCTATAGCTACTACAGACT | PFL_3147 |
| Pseudomonas mendocina ymp | ||||
|
Position: -115
Score: 6.29557 Sequence: ACCCTGTAGTAACTACAGGGA
Locus tag: Pmen_1174
Name: czcR Funciton: DNA-binding heavy metal response regulator
Locus tag: Pmen_1173
Name: PF00512 Funciton: Heavy metal sensor histidine kinase |
||||
| czcR-PF00512 | -115 | 6.3 | ACCCTGTAGTAACTACAGGGA | Pmen_1174 |
| Pseudomonas putida KT2440 | ||||
|
Position: -56
Score: 5.8445 Sequence: ACCCTGATGTCACTACAGGGT
Locus tag: PP1438
Name: czcR Funciton: DNA-binding heavy metal response regulator
Locus tag: PP1437
Name: PF00512 Funciton: Heavy metal sensor histidine kinase |
||||
| czcR-PF00512 | -56 | 5.8 | ACCCTGATGTCACTACAGGGT | PP1438 |