Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing czcB gene

Properties
Regulog: CadR-PbrR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 13 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -63
Score: 6.1543
Sequence: ACCCTCTAGTAACTATAGAGT
Locus tag: CJA_1839
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: CJA_1840
Name: null
Funciton: hypothetical protein
Locus tag: CJA_1841
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: CJA_1842
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: CJA_1843
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD-CJA_1840-czcC-czcB-czcA -63 6.2 ACCCTCTAGTAACTATAGAGT CJA_1839
Saccharophagus degradans 2-40
Position: -57
Score: 6.29717
Sequence: ACTCTATAGTTACTATAGAGT
Locus tag: Sde_1960
Name: czcD
Funciton: Co/Zn/Cd efflux protein
Locus tag: Sde_1959
Name: null
Funciton: hypothetical protein
Locus tag: Sde_1958
Name: czcC
Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: Sde_1957
Name: null
Funciton: hypothetical protein
Locus tag: Sde_1956
Name: czcB
Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sde_1955
Name: czcA
Funciton: Heavy metal efflux RND transmembrane protein
czcD-Sde_1959-czcC-Sde_1957-czcB-czcA -57 6.3 ACTCTATAGTTACTATAGAGT Sde_1960