Orthologous regulated operons containing czcC gene
| Regulog: | CadR-PbrR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -63
Score: 6.1543 Sequence: ACCCTCTAGTAACTATAGAGT
Locus tag: CJA_1839
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: CJA_1840
Name: null Funciton: hypothetical protein
Locus tag: CJA_1841
Name: czcC Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: CJA_1842
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: CJA_1843
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein |
||||
| czcD-CJA_1840-czcC-czcB-czcA | -63 | 6.2 | ACCCTCTAGTAACTATAGAGT | CJA_1839 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -57
Score: 6.29717 Sequence: ACTCTATAGTTACTATAGAGT
Locus tag: Sde_1960
Name: czcD Funciton: Co/Zn/Cd efflux protein
Locus tag: Sde_1959
Name: null Funciton: hypothetical protein
Locus tag: Sde_1958
Name: czcC Funciton: Heavy metal efflux RND outer membrane protein
Locus tag: Sde_1957
Name: null Funciton: hypothetical protein
Locus tag: Sde_1956
Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein
Locus tag: Sde_1955
Name: czcA Funciton: Heavy metal efflux RND transmembrane protein |
||||
| czcD-Sde_1959-czcC-Sde_1957-czcB-czcA | -57 | 6.3 | ACTCTATAGTTACTATAGAGT | Sde_1960 |